http://www.answerbag.com/profile/241967 New Answerbag answers from Alice dee Tue, 29 May 2012 09:22:09 -0700 Tue, 29 May 2012 09:22:09 -0700 http://www.answerbag.com/a_view/10502883 If you found religion that claimed that Jesus was a time traveler who battles aliens moves thru history and killed Hitler would you join?<br /><br />Hmm its justs as believable as everyone else's religion, but i still wouldn't join. Sun, 27 Mar 2011 01:46:56 -0700 http://www.answerbag.com/a_view/10502883 http://www.answerbag.com/a_view/6663693 Why do people label Barack Obama as a black man when he is half white and was raised by his WHITE family?<br /><br />Why do you give a fuck about race. Do you have a probalen with it? Sun, 31 May 2009 20:24:18 -0700 http://www.answerbag.com/a_view/6663693 http://www.answerbag.com/a_view/6663636 What is your favorite brand of hot dogs?<br /><br />it sure is hellers Sun, 31 May 2009 20:17:45 -0700 http://www.answerbag.com/a_view/6663636 http://www.answerbag.com/a_view/6655826 Have you felt very sheepish lately?<br /><br />no, they keep getting away Sun, 31 May 2009 01:50:48 -0700 http://www.answerbag.com/a_view/6655826 http://www.answerbag.com/a_view/6655774 When a guy u live with constantly gives u eye contact & u do the same, does that mean something? & if the 2 of u like 2 spend nights together just vegging mean something & u tell 1 another where your going & etc?? Is there something more than he's saying?<br /><br />if you like this guy, just tell him, or better yet just kiss him, instead of wasting time askin questions about it. Make a move. Sun, 31 May 2009 01:38:17 -0700 http://www.answerbag.com/a_view/6655774 http://www.answerbag.com/a_view/6110900 Has sex with a girl from about 10 days, and afet this i have Cough and cold and heat but I do not know if she has AIDS or not and that was how I know I am have also AIDS from her or not plz told me i can't sleep?<br /><br />Doesn&#039;t sound good, especially if you can&#039;t sleep. As long as you don&#039;t have a fever, that goes away really fast, you shouldn&#039;t be contagious, I mean sick. Mon, 06 Apr 2009 04:34:02 -0700 http://www.answerbag.com/a_view/6110900 http://www.answerbag.com/a_view/6110878 I hit my knee with my tennis racquet while serving. there is no inflammation, just pain when bending and some mild bruising. what should i do? it has been 24 hours.<br /><br />I recommend taking a concrete pill Mon, 06 Apr 2009 04:27:05 -0700 http://www.answerbag.com/a_view/6110878 http://www.answerbag.com/a_view/6110867 What do you do when your in deep shit<br /><br />funny thing about shit, good things seem to grow out of it Mon, 06 Apr 2009 04:23:15 -0700 http://www.answerbag.com/a_view/6110867 http://www.answerbag.com/a_view/6110832 Has anyone used Forex MegaDroid? What were your results?<br /><br />All I will say is, if you have one ounce of doubt and you think it could be a scam, its always a scam. Mon, 06 Apr 2009 04:15:31 -0700 http://www.answerbag.com/a_view/6110832 http://www.answerbag.com/a_view/6110824 According to copyright law, can someone knowingly produce something that looks ALMOST like my design but not exactly? Where is the line drawn?<br /><br />There has to be 22 differences, I have to do it all the time at work. Mon, 06 Apr 2009 04:12:32 -0700 http://www.answerbag.com/a_view/6110824 http://www.answerbag.com/a_view/6110820 IQ question: red throw pitch saloon bar rod tree tip end seat ----- meals.(where one dash equals one letter...5 dashes.) I answered the other 19 but this one eludes me. Help...please ! It is driving me nuts !<br /><br />Red and meals are just to throw you off, everything else is in pairs, (throw, pitch) (saloon, bar) (rod, tree) (tip,end) so seat , _ _ _ _ _ I&#039;m not gonna solve it for you tho, just giving you a hint. Mon, 06 Apr 2009 04:11:23 -0700 http://www.answerbag.com/a_view/6110820 http://www.answerbag.com/a_view/6110769 Grandfather say.. "What does it profit a man to gain all the answers and lose what STUFF it took to get them"?<br /><br />&quot;wise is the gent, counting every moment spent&quot; Mon, 06 Apr 2009 03:57:34 -0700 http://www.answerbag.com/a_view/6110769 http://www.answerbag.com/a_view/6110759 The term "you have your head up your ass" can it have multiple meanings? Can it be used in many ways?<br /><br />2 ways I know of e.g. &#039;Your heads so far up your ass you can see yourself chewing&#039; meaning that they are blind to whats really going on. Or that they are so self righteous that they like the smell of their own farts. Mon, 06 Apr 2009 03:55:00 -0700 http://www.answerbag.com/a_view/6110759 http://www.answerbag.com/a_view/6110740 Is it true, that if you stick a sleeping persons hand in cold water they will pee in their sleep?<br /><br />Not true at all, warm water on the other hand tho, piss everywhere. Mon, 06 Apr 2009 03:50:54 -0700 http://www.answerbag.com/a_view/6110740 http://www.answerbag.com/a_view/6110736 Do you or anyone you know worship satan? If so do you know why?<br /><br />I don&#039;t worship satan, or condone it. But only on the grounds that admitting his existance admits the exsistance of god. Because god is a real as the easter bunny and the tooth fairy. You should be happy with satanists, at least they aknowledge the existance of your fake prophets Mon, 06 Apr 2009 03:49:59 -0700 http://www.answerbag.com/a_view/6110736 http://www.answerbag.com/a_view/6110706 I am about to travel overseas and need a secure, reliable, and fast online backup website for my images that will not compress the image in any way... Any suggestions? Thanks!<br /><br />I just started using flickr.com, seems to be exactly what you&#039;re after Mon, 06 Apr 2009 03:42:20 -0700 http://www.answerbag.com/a_view/6110706 http://www.answerbag.com/a_view/6110691 Why do atheists celebrate Christian holidays?<br /><br />I don&#039;t celebrate halloween, and I&#039;m not an atheist, I&#039;m nothing. Mon, 06 Apr 2009 03:38:37 -0700 http://www.answerbag.com/a_view/6110691 http://www.answerbag.com/a_view/6110681 Why does US currency have "In God We Trust" written all over it?<br /><br />Bacuase Americans are stupid enough to &quot;trust&quot; imaginary creatures. On their bonds it says &quot; in easter bunny we trust&quot; Mon, 06 Apr 2009 03:35:07 -0700 http://www.answerbag.com/a_view/6110681 http://www.answerbag.com/a_view/6110665 Hello I want to hack another computers?? this is possible???who can answers me please this question....<br /><br />I answer question can. Hack other computer bad. friends get you should. Mon, 06 Apr 2009 03:31:52 -0700 http://www.answerbag.com/a_view/6110665 http://www.answerbag.com/a_view/5983538 Are white guys with dreadlocks who smoke ganja and call theirself Rastas recognized and accepted as real Rastafarians by real Jamaican Rastafarians?<br /><br />nah they just stoners Thu, 19 Mar 2009 23:27:45 -0700 http://www.answerbag.com/a_view/5983538 http://www.answerbag.com/a_view/5983399 In terms of temporary and/or permanent damage, how dangerous is it for an amateur to sew their own lips shut?<br /><br />Steralize everything and you&#039;ll be fine Thu, 19 Mar 2009 22:57:13 -0700 http://www.answerbag.com/a_view/5983399 http://www.answerbag.com/a_view/5983272 What is the format that lets you put 100 or more songs on 1 cd.<br /><br />mp3 Thu, 19 Mar 2009 22:29:07 -0700 http://www.answerbag.com/a_view/5983272 http://www.answerbag.com/a_view/5983261 Have you any suggestion to stop crimes?<br /><br />make everything legal Thu, 19 Mar 2009 22:28:23 -0700 http://www.answerbag.com/a_view/5983261 http://www.answerbag.com/a_view/5961182 My life has become a hell. Why i dont know can u pl tell me?<br /><br />You just need to chill out and look on the bright side of things. Also it could be due to abbreviating words that you should just type in full. Wed, 18 Mar 2009 01:45:40 -0700 http://www.answerbag.com/a_view/5961182 http://www.answerbag.com/a_view/5961165 Does anyone know where Osama is?<br /><br />Didn&#039;t he shave, buy some clothes at a mall and move into the white house Wed, 18 Mar 2009 01:41:52 -0700 http://www.answerbag.com/a_view/5961165 http://www.answerbag.com/a_view/5961159 If are the last human being living onEarth what will you do?<br /><br />Probably die, we&#039;re all going to anyway. Wed, 18 Mar 2009 01:39:53 -0700 http://www.answerbag.com/a_view/5961159 http://www.answerbag.com/a_view/5961143 Whay do so many people make fun of canadians?<br /><br />Well for starters you spell why without an &quot;a&quot; in the rest of the world, although you didn&#039;t finish your sentence with &quot;aye?&quot; or say aboot, so I&#039;m doubting you&#039;re even canadian. I just joking though, I&#039;ll tell you one thing tho buddy, people might make fun... Wed, 18 Mar 2009 01:36:42 -0700 http://www.answerbag.com/a_view/5961143 http://www.answerbag.com/a_view/5936706 Alright people, lets do this. Let the Chuck Norris jokes be listed. They make me laugh.<br /><br />They say under his beard there is no chin, only another fist. When Chuck Norris falls in the ocean, he doesn&#039;t get wet, the ocean gets Chuck Norris Mon, 16 Mar 2009 00:33:42 -0700 http://www.answerbag.com/a_view/5936706 http://www.answerbag.com/a_view/5936690 How can supply creates its own demand?<br /><br />Easy, consumables. You should really be doing your own homework tho. Mon, 16 Mar 2009 00:31:10 -0700 http://www.answerbag.com/a_view/5936690 http://www.answerbag.com/a_view/5936675 If you like Nine Inch Nails, what did you think of their album Pretty Hate Machine?<br /><br />Good, but not as good as the downward spiral Mon, 16 Mar 2009 00:29:27 -0700 http://www.answerbag.com/a_view/5936675 http://www.answerbag.com/a_view/5936652 I've tried to download the iTunes software three times now, and it won't let me. Why?<br /><br />Because apple is gay Mon, 16 Mar 2009 00:26:42 -0700 http://www.answerbag.com/a_view/5936652 http://www.answerbag.com/a_view/5936648 I just got games downloaded to my computer now how do i put them on my psp?<br /><br />USB cable? Mon, 16 Mar 2009 00:25:57 -0700 http://www.answerbag.com/a_view/5936648 http://www.answerbag.com/a_view/5936595 Whats your favorite Mastadon song?<br /><br />Linoleum Knife, the intro for the &quot;Aqua Teen Hunger Force&quot; movie. Mon, 16 Mar 2009 00:17:42 -0700 http://www.answerbag.com/a_view/5936595 http://www.answerbag.com/a_view/5936559 I met harvey out of so solid crew and got off with him in a club- shud i go 2 the papers? x<br /><br />That depends, are you a dirty slut, or do you just want the whole world to think you are. Mon, 16 Mar 2009 00:12:35 -0700 http://www.answerbag.com/a_view/5936559 http://www.answerbag.com/a_view/5936547 How do you save a movie on the hard drive of a playstation 3 80g. or would i need the disk to watch it everytime<br /><br />First you need to use your pc to convert the dvd to avi or other such file type, then you can convert that file to mp4 (if you&#039;re lucky you can find some software that converts from dvd straight to mp4), so you can store it on the ps3, I have 20 something movies on my ps3, I&#039;ve even... Mon, 16 Mar 2009 00:10:21 -0700 http://www.answerbag.com/a_view/5936547 http://www.answerbag.com/a_view/5936523 What is "the secret life of bees" about<br /><br />bees Mon, 16 Mar 2009 00:05:38 -0700 http://www.answerbag.com/a_view/5936523 http://www.answerbag.com/a_view/5936521 2) What is the relationship between ethical practices and profit?<br /><br />Do your own homework, otherwise you&#039;ll always be a retard. You weren&#039;t even smart enough to remove the &quot;2)&quot; from the front. Mon, 16 Mar 2009 00:04:40 -0700 http://www.answerbag.com/a_view/5936521 http://www.answerbag.com/a_view/5936507 When Joey of "Friends" is attracted to a woman he says "How you doing?"<br /><br />Did you have a question to go along with the blatant statement that you just made? By the way he said &quot;how you doin?&quot; which is a question, you can learn from it, it proposes a situation, and has a question mark at the end too. Mon, 16 Mar 2009 00:02:43 -0700 http://www.answerbag.com/a_view/5936507 http://www.answerbag.com/a_view/5936497 Why is it many people do not like you asking if they have a question when they post a statement?<br /><br />Thats a good one, I usually ask why they think this site is called statementbag. Must just be because they are a few points short of a level, I think you know what I mean. Sun, 15 Mar 2009 23:59:55 -0700 http://www.answerbag.com/a_view/5936497 http://www.answerbag.com/a_view/5936489 Replication of the E. coli chromosome takes 40-45 minutes, but the organism has a generation time of 26 minutes (under ideal conditions). How does the cell have time to make a complete chromosome for each daughter cell?<br /><br />Do your own homework, otherwise you&#039;ll always be a retard Sun, 15 Mar 2009 23:57:57 -0700 http://www.answerbag.com/a_view/5936489 http://www.answerbag.com/a_view/5936486 HIV, the virus that causes AIDS, was isolated from three individuals, and the amino acid sequences for a portion of a viral coat protein were determined. Of the amino acid sequences shown below, which two of the viruses are most closely related?<br /><br />Do your own homework, otherwise you&#039;ll always be a retard Sun, 15 Mar 2009 23:57:24 -0700 http://www.answerbag.com/a_view/5936486 http://www.answerbag.com/a_view/5936485 Why does the use of DNA Polymerase from the bacterium Thermus aquaticus allow researchers to add the necessary reagents to tubes in a preprogrammed heating block and recover amplified DNA? Would the DNA polymerase from an organism like Bacillus megaterium<br /><br />Do your own homework, otherwise you&#039;ll always be a retard Sun, 15 Mar 2009 23:57:17 -0700 http://www.answerbag.com/a_view/5936485 http://www.answerbag.com/a_view/5936480 Why does the use of DNA polymerase from the bacterium Thermus aquaticus allow researchers to add the necessary reagents to tubes in a preprogrammed heating block and recover amplified DNA? would the DNA polyerasefrom an organsim like Bacillus meaterium<br /><br />Do your own homework, otherwise you&#039;ll always be a retard Sun, 15 Mar 2009 23:56:34 -0700 http://www.answerbag.com/a_view/5936480 http://www.answerbag.com/a_view/5936470 Given the following sequence of DNA produce the following: A. The mRNA directly transcribed from this piece of DNA (2 pts) B. The peptide sequence translated from that mRNA *HINT* Remember to account for directionality. 5’- TTACCGGTGCACACCCATCC -3<br /><br />Do your own homework, otherwise you&#039;ll always be a retard Sun, 15 Mar 2009 23:54:37 -0700 http://www.answerbag.com/a_view/5936470 http://www.answerbag.com/a_view/5936466 Y do ppl act lik ppl theyre not<br /><br />Y do ppl tlk in stpid txt lngo. And post stupid questions in the wrong catagory. I think you accidentally posted this question instead of txting it to one of your 14 yr old friends. Sun, 15 Mar 2009 23:53:20 -0700 http://www.answerbag.com/a_view/5936466 http://www.answerbag.com/a_view/5936429 What do you know about the North American Union?<br /><br />It was a big mistake. Sun, 15 Mar 2009 23:42:34 -0700 http://www.answerbag.com/a_view/5936429 http://www.answerbag.com/a_view/5936417 Ricer BS or no? Kid drives an eclipse. ask him his 1/4 time, he tells me 0-60 in 2.6 and the quarter in 15 flat. WTF?<br /><br />Down here we have &quot;ricers&quot; as you racially put it, doing 5 sec passes, so no bs buddy. 15 is slow Sun, 15 Mar 2009 23:40:31 -0700 http://www.answerbag.com/a_view/5936417 http://www.answerbag.com/a_view/5936409 Im looking for a song that came out in 2001 0r 2002 its hard rock, and it starts out "its the drugs , the drugs<br /><br />Are you sure it doesn&#039;t go &quot;I don&#039;t like the drugs, but the drugs like me&quot; or &quot;I&#039;m on the drug, I&#039;m on the drug, I&#039;m on the drug that killed River Pheonix&quot; Listen to the reefer song, by mindless, (its on youtube) you&#039;ll like it Sun, 15 Mar 2009 23:38:38 -0700 http://www.answerbag.com/a_view/5936409 http://www.answerbag.com/a_view/5936398 Which do you prefer plain soda water or mineral water?<br /><br />I only drink, I believe the french say, Du Robinet, water. Never heard of it, babelfish it. Sun, 15 Mar 2009 23:32:12 -0700 http://www.answerbag.com/a_view/5936398 http://www.answerbag.com/a_view/5936371 What is going on in Billy Corgan's head?<br /><br />Thoughts, such as whats for tea. Sun, 15 Mar 2009 23:26:59 -0700 http://www.answerbag.com/a_view/5936371 http://www.answerbag.com/a_view/5936327 Why do we see dreams<br /><br />because we need to. Sun, 15 Mar 2009 23:21:45 -0700 http://www.answerbag.com/a_view/5936327 http://www.answerbag.com/a_view/5936310 Do you have friend from your job?<br /><br />I live with 2 workmates, and Im friends with everyone at work. So, yes. Sun, 15 Mar 2009 23:19:12 -0700 http://www.answerbag.com/a_view/5936310 http://www.answerbag.com/a_view/5936303 I have this one question about homos that got rejected/spam cause it's considered offensive.....To everyone who feel offended because of that,i'm really sorry..Would you ever forgive me?<br /><br />Don&#039;t worry about those fuckin fags, they&#039;re to busy blowing each others meat trumpets to notice whats really going on in the world. +4 for you Sun, 15 Mar 2009 23:17:55 -0700 http://www.answerbag.com/a_view/5936303 http://www.answerbag.com/a_view/5936261 Write the equation of this switching network then simplify diagram at http://tinypic.com/view.php?pic=3090ubr&s=5<br /><br />Do your own homework, otherwise you&#039;ll always be a retard Sun, 15 Mar 2009 23:12:01 -0700 http://www.answerbag.com/a_view/5936261 http://www.answerbag.com/a_view/5936245 Why do some really powerful race cars spit flames through the exhaust pipes when they change gears? and is there a name for this?<br /><br />A backfire, or simply popping flames, usually due to running too rich, so excess unburnt fuel makes it all the way to the exhaust, then the hot exhaust plus the oxygen rich enviroment cause detonation. Sun, 15 Mar 2009 23:09:45 -0700 http://www.answerbag.com/a_view/5936245 http://www.answerbag.com/a_view/5936234 My PS3 60 gb will not save data on Resident Evil 5. A week ago I also bought Star Wars force unleashed and I have the same problem. So I bought another game to see if it was my sytem and I was able to save that game. Any ideas?<br /><br />Have you got &quot;less than 500mb free remaining&quot; on your screen, I had this problem with LBP, freed up some space and problem was gone. Try the Playstation forums if it doesn&#039;t work. Sun, 15 Mar 2009 23:07:51 -0700 http://www.answerbag.com/a_view/5936234 http://www.answerbag.com/a_view/5936218 Why is TV a wmd?<br /><br />Because its destroying your mind and everyone elses Sun, 15 Mar 2009 23:05:47 -0700 http://www.answerbag.com/a_view/5936218 http://www.answerbag.com/a_view/5936214 In texas hold em if a player has 2 pair jacks and nines and his opponent also has two pair kingks and threes who wins<br /><br />The kings win Sun, 15 Mar 2009 23:04:05 -0700 http://www.answerbag.com/a_view/5936214 http://www.answerbag.com/a_view/5936172 I have a one year old yorkey, He seems to have an erection for long periods of time, some times not compleatley retracting, he has not been fixed, and this is a new developement. what should i do?<br /><br />Stick out your leg and let him go at it. Sun, 15 Mar 2009 22:56:12 -0700 http://www.answerbag.com/a_view/5936172 http://www.answerbag.com/a_view/5936168 How do I unlock my Password on a PSP I purchased on eBay.<br /><br />What password? If you mean the 4 digit code for either browser control or parental control, the standard code is 0000, otherwise you&#039;re gonna have to e-mail whoever you bought it off. Sun, 15 Mar 2009 22:55:25 -0700 http://www.answerbag.com/a_view/5936168 http://www.answerbag.com/a_view/5936110 What do you do about a neighbor whose cat takes delight in destroying others property?<br /><br />Ask them to deal with it, or lay in wait with a soft air rifle and scare the shit out of the feral feline Sun, 15 Mar 2009 22:46:34 -0700 http://www.answerbag.com/a_view/5936110 http://www.answerbag.com/a_view/5936039 What four climates can be found in Kazakhstan?<br /><br />Cold, Hot, Uranium and the Jew Sun, 15 Mar 2009 22:34:11 -0700 http://www.answerbag.com/a_view/5936039 http://www.answerbag.com/a_view/5936018 Do you have a bong? plastic or glass?<br /><br />I have a bong that I made out of a plastic bottle, a length of garden hose and a 78ths socket (because we use metric here). But I stopped using it a while ago, my friend kept on getting pluracy from the water vapour, so now I only use bucket bongs on a rare occasion, and try to avoid regular... Sun, 15 Mar 2009 22:30:53 -0700 http://www.answerbag.com/a_view/5936018 http://www.answerbag.com/a_view/5935991 How many black men, women, and childred are in the United States.<br /><br />Doesn&#039;t matter, race should never be an issue Sun, 15 Mar 2009 22:26:09 -0700 http://www.answerbag.com/a_view/5935991 http://www.answerbag.com/a_view/5935928 If microscopic fluctuations in the fabric of space and time spawned the universe doesn't that imply that there was already one to begin with?<br /><br />Nope, it just implicates the existence of space and time fabric, which by the way is incredibly hard to sew, due to the fluctuations. Sun, 15 Mar 2009 22:18:10 -0700 http://www.answerbag.com/a_view/5935928 http://www.answerbag.com/a_view/5935861 Ever been to the drag races. or seen it on tv, when they do their burn out and so much tire smoke fills the area. All of these people working in that smoke... this can't be good for these people can it?<br /><br />Who cares, it smells great, and is always a crowd pleaser, the people working there are doing it for the love of the sport, so I&#039;m sure they don&#039;t mind. Sun, 15 Mar 2009 22:08:19 -0700 http://www.answerbag.com/a_view/5935861 http://www.answerbag.com/a_view/5935656 Which do you like better opinionated questions with no correct answer, ridiculous questions that can have anything for an answer, or a 1 answer question. Which do you like asking? Which do you like answering?<br /><br />Opinionated questions with mo correct answer are usually statements with a question at the end, I like answering those because I get to wind up the idiot that thinks this place is called statementbag. Ridiculous questions are great too, because its a chance to leave a ridiculous answer. 1 answer... Sun, 15 Mar 2009 21:44:06 -0700 http://www.answerbag.com/a_view/5935656 http://www.answerbag.com/a_view/5935598 What things can you do without?<br /><br />Self loathing, and lack of motivation. Sun, 15 Mar 2009 21:39:00 -0700 http://www.answerbag.com/a_view/5935598 http://www.answerbag.com/a_view/5935593 I want to contect my 360 to my pc and be on line via my pc, i have a modem so i have to keep changing the ethernet cable to go online on eather pc or 360 is they a way i can have both on via my modem<br /><br />Just buy an ethernet switch, I&#039;ve got a 10 port hooked up to our wireless router, we&#039;ve got like 3 cables running through the house, plus wifi access. Sun, 15 Mar 2009 21:38:30 -0700 http://www.answerbag.com/a_view/5935593 http://www.answerbag.com/a_view/5935574 How can i tell when the last time my friend was on orkut<br /><br />Ask them, bloody spies. Sun, 15 Mar 2009 21:36:20 -0700 http://www.answerbag.com/a_view/5935574 http://www.answerbag.com/a_view/5935555 Who is osama bin laden<br /><br />He&#039;s the guy that does the voice for shrek Sun, 15 Mar 2009 21:34:06 -0700 http://www.answerbag.com/a_view/5935555 http://www.answerbag.com/a_view/5935513 If an average woman's vagina is 3 inches deep and expands just 1 more inch, then why is the size of a guy's pecker prominent for good sex according to some women?<br /><br />I dunno what vagina you&#039;ve been poking around in to get those averages. I&#039;ve been a bit deeper than that buddy. Sun, 15 Mar 2009 21:29:07 -0700 http://www.answerbag.com/a_view/5935513 http://www.answerbag.com/a_view/5935481 Do the uniformed have an mysterious quality<br /><br />Yeah, usually gayness. Don&#039;t take my word for it, talk to a salior. Sun, 15 Mar 2009 21:26:23 -0700 http://www.answerbag.com/a_view/5935481 http://www.answerbag.com/a_view/5935469 Why some stiletto boots are sexy?<br /><br />Because they give the appearance of legs that go all the way up to your armpits, mmmmmm. Sun, 15 Mar 2009 21:25:27 -0700 http://www.answerbag.com/a_view/5935469 http://www.answerbag.com/a_view/5935456 Name something that is not real in this world.<br /><br />Global warming, the tooth fairy, the easter bunny, god, jesus, the recession, performance ford, free lunch, honest women, smart americans, righteous christians, cheap jews. Sun, 15 Mar 2009 21:23:52 -0700 http://www.answerbag.com/a_view/5935456 http://www.answerbag.com/a_view/5935424 My spice rack came with a jar of mint. What kinds of foods do you season with mint?<br /><br />Lamb goes really nice with a mint sauce, even beef and pork too. Sun, 15 Mar 2009 21:20:29 -0700 http://www.answerbag.com/a_view/5935424 http://www.answerbag.com/a_view/5935312 What is your name? What is your quest? What is your favorite color?<br /><br />Alice Dee To answer questions and remind idiots that they are infact idiots Green Sun, 15 Mar 2009 21:12:09 -0700 http://www.answerbag.com/a_view/5935312 http://www.answerbag.com/a_view/5935299 A great Dane has had its way and bred my beloved Doberman. What problems might I encounter through the pregnancy?<br /><br />I dunno, but I want one of those puppies Sun, 15 Mar 2009 21:10:56 -0700 http://www.answerbag.com/a_view/5935299 http://www.answerbag.com/a_view/5935265 I lived in an apt. 32 years ago. I just found out my mother-in-law's housekeeper lives in the identical apt. today. What are the odds?<br /><br />Pretty good, since it happened that is. Sun, 15 Mar 2009 21:07:34 -0700 http://www.answerbag.com/a_view/5935265 http://www.answerbag.com/a_view/5935184 Would you bet your ass that you could draw the ace of spades from a deck of cards if the reward was 50 million dollars?<br /><br />Define &quot;ass&quot; a little clearer for me. Sun, 15 Mar 2009 20:58:49 -0700 http://www.answerbag.com/a_view/5935184 http://www.answerbag.com/a_view/5935143 What are your favorite foods to eat with Nutella?<br /><br />Bread Sun, 15 Mar 2009 20:55:41 -0700 http://www.answerbag.com/a_view/5935143 http://www.answerbag.com/a_view/5935113 Why do guys try to play when girls always win itz like playerz think there playing but there really being played never mind u guys wont know what im talkin bout never mind dont answer this kk sorry<br /><br />I know exactly what your saying, girls are dirtier than guys. Thats a fact. And they never mean what they say. Thats why I don&#039;t hook up with sluts, even tho there are so so many. I thought being a nice guy I was a rare find, but an even rarer find is a nice girl, unless your looking for a... Sun, 15 Mar 2009 20:53:38 -0700 http://www.answerbag.com/a_view/5935113 http://www.answerbag.com/a_view/5935032 How much would it cost to powder coat a set of rims?<br /><br />It costs about $40NZ a rim, last time my flatmate got his done anyway. Sun, 15 Mar 2009 20:47:06 -0700 http://www.answerbag.com/a_view/5935032 http://www.answerbag.com/a_view/5935021 What is an over the counter drug that's bad for you? Why is it bad?<br /><br />Nicotine, its habit forming. Sun, 15 Mar 2009 20:46:16 -0700 http://www.answerbag.com/a_view/5935021 http://www.answerbag.com/a_view/5935010 If I told you I'm Wiccan, would you still love me?<br /><br />Of course, I love crazy girls. Sun, 15 Mar 2009 20:45:29 -0700 http://www.answerbag.com/a_view/5935010 http://www.answerbag.com/a_view/5935001 Why is the hamburger called "ham"burger when it's made of beef and not ham?<br /><br />Why are they caled french fries, why is it called sheperds pie, age old questions really. But if you want a real brain bender, if whoever named carrots and oranges named them the other way round, would the general lee be carrot? Sun, 15 Mar 2009 20:44:43 -0700 http://www.answerbag.com/a_view/5935001 http://www.answerbag.com/a_view/5934981 So guys, when a girl tells you on a first date that she is Bi, how do YOU react?<br /><br />I go Woooo Hoooo!! Sun, 15 Mar 2009 20:42:21 -0700 http://www.answerbag.com/a_view/5934981 http://www.answerbag.com/a_view/5934969 Who are you and what are you doing at my house?<br /><br />What do you mean? This is my house. Sun, 15 Mar 2009 20:41:26 -0700 http://www.answerbag.com/a_view/5934969 http://www.answerbag.com/a_view/5902430 Were can I find the reset button on my psp<br /><br />Under the battery Fri, 13 Mar 2009 03:53:12 -0700 http://www.answerbag.com/a_view/5902430 http://www.answerbag.com/a_view/5902376 Why my PS3 install it when every PS3 game for the first time it played?<br /><br />The game stores some information on your hard drive to save on loading times Fri, 13 Mar 2009 03:41:21 -0700 http://www.answerbag.com/a_view/5902376 http://www.answerbag.com/a_view/5902254 Whats the most money you've ever tipped?<br /><br />$0, I&#039;ve never tipped in my life. It doesn&#039;t happen here in New Zealand Fri, 13 Mar 2009 03:17:24 -0700 http://www.answerbag.com/a_view/5902254 http://www.answerbag.com/a_view/5902247 Whats an impressive to learn on guitar, but really isn't that hard to play?<br /><br />Plug in baby by Muse You have to play it fast tho Fri, 13 Mar 2009 03:16:37 -0700 http://www.answerbag.com/a_view/5902247 http://www.answerbag.com/a_view/5902066 What ps1 games can you recommend me?<br /><br />Gran turismo 1 and 2, Grand theft auto 1 and 2, Bloody Roar 1 and 2, Tony hawks Skateboarding 1 and 2, Dave Mirra BMX, Worms, Suikoden, Driver, Crash Bndicoot, Tomb Raider, Vagina, Syphon Filter, Rainbow Six, Colin Mcrae Rally, Metal Gear Solid, Wipeout, Road Rash, Tekken, Porsche Challenge,... Fri, 13 Mar 2009 02:34:45 -0700 http://www.answerbag.com/a_view/5902066 http://www.answerbag.com/a_view/5901937 I took a sleeping pill yrsterday but it didn't work. what's wrong?<br /><br />You&#039;re still awake. Fri, 13 Mar 2009 01:54:06 -0700 http://www.answerbag.com/a_view/5901937 http://www.answerbag.com/a_view/5901934 How long will it take to bake 50 potatoes in the oven?<br /><br />How big is your oven Fri, 13 Mar 2009 01:53:36 -0700 http://www.answerbag.com/a_view/5901934 http://www.answerbag.com/a_view/5901932 When was money made how much do the money in our world is the most<br /><br />7 Fri, 13 Mar 2009 01:53:07 -0700 http://www.answerbag.com/a_view/5901932 http://www.answerbag.com/a_view/5901923 What are the most common faults developed in a motor?<br /><br />Heater ducting, and low headlight fluid Fri, 13 Mar 2009 01:50:35 -0700 http://www.answerbag.com/a_view/5901923 http://www.answerbag.com/a_view/5901912 I have a 15 yr. old son who has spoked marijuana in the past. Is there a way that he can pass a urine test even if he has been using? I bought a test from CVS and we also had him tested at an Addiction Clinic and they both came back as negative.<br /><br />Just piss in the cup for him. Un less of course you have been spoking too much yourself. Fri, 13 Mar 2009 01:48:22 -0700 http://www.answerbag.com/a_view/5901912 http://www.answerbag.com/a_view/5901860 What were women like during world war 1<br /><br />scared Fri, 13 Mar 2009 01:36:45 -0700 http://www.answerbag.com/a_view/5901860 http://www.answerbag.com/a_view/5901852 Has anyone bought cigs lately in the non mandated fsc states that taste terrible now but are NOT going out and NOT marked FSC..?<br /><br />What the FSC are you talking about? Fri, 13 Mar 2009 01:34:29 -0700 http://www.answerbag.com/a_view/5901852