- NEW!
The study of heredity and how things are carried on from generation to generation
Did you prefer one parent over the other? yes/no ?Why?
by Bornabrit on February 7th, 2012
| 13 people like this
|
16 answers
|
in Human genetics
How old does a baby need to be before you do a paternity test?
by Answerbag Staff on May 23rd, 2010
|
2 answers
|
in Human genetics
What color is your hair? Is it the same as your mother or your father?
by neverenough on February 7th, 2012
| 7 people like this
|
16 answers
|
in Human genetics
Is blonde hair recessive or dominant?
by Answerbag Staff on April 20th, 2010
|
6 answers
|
in Human genetics
Should we stop sex and make children in labs? In this way we wont waste our time for marriage and we can love boys and girls alike !
by LoverOfSophia on February 4th, 2012
|
2 answers
|
in Human genetics
When was dna technology first used in forensics?
by Answerbag Staff on December 15th, 2009
|
2 answers
|
in Human genetics
If I am O+ and all 3 of my children are B- what blood type is my husband?
by theynoski on January 27th, 2012
| 1 person likes this
|
2 answers
|
in Human genetics
If the moon had four dark patches rather than three, then would we have evolved with two mouths or three eyes?
by Ombliss22 on January 24th, 2012
|
one answer
|
in Human genetics
Can two Wongs make a Wright?
by Piano Player on January 9th, 2012
| 1 person likes this
|
11 answers
|
in Human genetics
Do you fit your genes?
by Weylon on January 8th, 2012
| 1 person likes this
|
4 answers
|
in Human genetics
what is crossing over of chromosomes??
by Akash_D on January 5th, 2012
| 1 person likes this
|
2 answers
|
in Human genetics
Do you have a raspy morning voice when you first wake up?
by Shelly_R on January 3rd, 2012
| 7 people like this
|
13 answers
|
in Human genetics
what color are my sister's and her friend's eyes?
by SouthernBelle14 on December 31st, 2011
|
4 answers
|
in Human genetics
Which traits of your mom do you have and which traits of your dad to you have?
by Alicia_P on December 29th, 2011
| 2 people like this
|
2 answers
|
in Human genetics
Is the color of your upper inner thighs darker then the rest of your skin? Whats your ethnicity?
by Badcube on December 25th, 2011
| 2 people like this
|
8 answers
|
in Human genetics
Do you have freckles? if yes, than what color is your hair?
by ❤Crith Angew Mindfweak❤ on December 5th, 2011
| 3 people like this
|
11 answers
|
in Human genetics
Does Genetic Ethnicity change Vocal chords like in the way we sound?
by Badcube on December 4th, 2011
|
one answer
|
in Human genetics
What are the chances of my future son/daughter having green eyes?
by ShortGirl1990 on December 1st, 2011
| 1 person likes this
|
3 answers
|
in Human genetics
Are my eyes dark brown or dark hazel?
by RockerChick15 on December 1st, 2011
| 1 person likes this
|
4 answers
|
in Human genetics
Which parent do you look more like?
by Alicia_P on November 26th, 2011
| 4 people like this
|
14 answers
|
in Human genetics
Why do some parents that both don't have brown eyes, have children that have brown eyes? I have heard that this is rare, but it happens.
by Alicia_P on November 26th, 2011
|
10 answers
|
in Human genetics
Without looking, what are the colour of your eyes ?
by lyonese01 on November 25th, 2011
| 10 people like this
|
31 answers
|
in Human genetics
if the world was a true melting pot and ethnicities cease to exist how long would it take before everyone was a of no distict race?
by lillouise on November 8th, 2011
|
one answer
|
in Human genetics
Are you opposed to helping people become beautiful when they've been genetically forsaken?
by Immogene on November 6th, 2011
| 3 people like this
|
15 answers
|
in Human genetics
I have 2 biracial sons by the same father,our older son is dark and our younger son is a white as me if not lighter, is this normal?
by happymama2 on November 2nd, 2011
|
2 answers
|
in Human genetics
What "facial appearance group" do you belong to?
I belong to the same group as Prince and Michael Jackson.
I'm white
by ❤Crith Angew Mindfweak❤ on October 27th, 2011
| 1 person likes this
|
7 answers
|
in Human genetics
Our genes do not predetermine our destiny. Or do they? It seems easier and easier to say that I am fat/lazy/stupid because of my
by DA BEN DAN yanggui zi on October 19th, 2011
| 3 people like this
|
2 answers
|
in Human genetics
Should people with genetic disorders be able to live and or reproduce? Why or why not?
by Anonymous on October 14th, 2011
|
one answer
|
in Human genetics
Happy with the deal you got from the genes that gave you your LOOKS?If not what are your peeves?
by ENigma on October 9th, 2011
| 6 people like this
|
12 answers
|
in Human genetics
How can Homosexuality be genetic if homos cant reproduce?
by Louie_Ranking on October 2nd, 2011
| 1 person likes this
|
4 answers
|
in Human genetics
How can I convince you that you're a genius?
by WABOO on October 2nd, 2011
| 5 people like this
|
15 answers
|
in Human genetics
If we get half our genes from our mom and half our genes from our dad, why do some of us look more like one parent than the other?
by Alicia_P on September 26th, 2011
| 2 people like this
|
one answer
|
in Human genetics
Could genetic engineering be done with adults? Implant specific DNA in an adult human for qualities like compassion/empathy/cooperation?
by RosieGHM Jetpacker on September 6th, 2011
| 2 people like this
|
4 answers
|
in Human genetics
Where can you pay to get your DNA/ Human Genome tested to see your ancestry?
by Badcube on August 27th, 2011
|
no answers
|
in Human genetics
my husband is 34 and has bluish green eyes both his parents have brown is it possible his mother messed around?
by Amanda_C4056 on August 12th, 2011
|
9 answers
|
in Human genetics
What is the average hand size for women and men?
by Kimi_T on August 7th, 2011
| 2 people like this
|
3 answers
|
in Human genetics
Which of the various European nationalities are the most f*cked up?
by zygon on July 20th, 2011
|
one answer
|
in Human genetics
Which of the following attaches to specific amino acids? Answer ribosomal RNA DNA messenger RNA transfer RNA RNA polymerase
by taylork_312 on July 19th, 2011
|
2 answers
|
in Human genetics
CCCTATCATCTTGTTACGACACGGAGTCATACGAGGAATATGGTTAATCTCTTGATAACGTTA
What is the sequence that is complementary to this template strand of DNA?
by John_S9229 on July 17th, 2011
|
one answer
|
in Human genetics
Scientists now claim Parasites May Have Given Birth to Sex. Do you think this is true?
by calicorey on July 13th, 2011
|
3 answers
|
in Human genetics
my nephew looks like my 2nd cousin(who looks exactly like his mother who is not blood related)could he be his father? We r Questioning it!
by ginny@crawfordgroup.com on July 7th, 2011
|
no answers
|
in Human genetics
are there any people out there trying to make a tail connected to nerves ? like with arms and feet. we could also make tails like that.
by hitokaji on July 5th, 2011
| 1 person likes this
|
2 answers
|
in Human genetics
What traits do girls inherit from their mothers?
by KATTALNUVA on June 5th, 2011
| 2 people like this
|
7 answers
|
in Human genetics
Your favorite Q&A site is on Facebook! Become a fan to connect with the ever-growing community of Answerbaggers, share your thoughts and find out what Answerbag's up to next!
